Domande e risposte: RNA fold


Domanda:
Ho provato ad applicare il metodo per l’identificazione di possibili strutture secondarie nell’RNA, descritto nella Figura 8.2, ma non riesco ad identificare nessuna regione di appaiamento.

Risposta:
Viene qui riportato e commentato un esempio in modo dettagliato.


Prima di tutto ci si assicuri che la sequenza abbia la possibità di formare appaiamenti interni. Ad esempio consideriamo la seguente sequenza.

5'- AGAGTTGCCAGATTGGTCTCTGGCAACCT -3'

che è in grado di formare questa struttura secondaria:


La sequenza è lunga 27 basi, quindi predisponiamo una matrice di 27x27 e riportiamo la sequenza sul lato sinistro, scrivendola normalmente dall’alto in basso, e sul lato superiore scrivendola come inverso complementare. Poi riempiamo ogni casella in cui le basi indicate a sinistra della riga e in alto alla colonna corrispondono. Il risultato sarà il seguente:

Bisogna effettivamente ammettee che il risultato non ci consente di evidenziare facilmente le regioni di possibile appaiamento, che dovrebbero apparire come coppie di diagonali. Il problema è dovuto al fatto che mediamente una casella su quattro è positiva (dal momento che ci sono quattro possibili basi diverse). Quindi il rumore di fondo è molto alto e maschera le diagonali, che ci sono, ma non sono molto evidenti.

Per risolvere questo problema possiamo modificare l'algoritmo di visualizzazione in modo che risultino marcate solo le caselle appartenenti a diagonali più lunghe di una certa soglia, che nell'immagine riportata sotto è stata fissata a 3.

Ora le regioni di possibile appaiamento sono molto più evidenti, in particolare la coppia di diagonali di nove caselle, che forma lo "stem" di nove basi appaiate raffigurato all'inizio della pagina.